Sequence (5’ to 3’) \(\epsilon_{260 nm}~(M^{-1}cm^{-1})\) DOI
TAGGGTGGGTTGGGTGGGGAAT 221500 10.1016/j.str.2012.09.013

       

Structure diagram of 2LXQ

Structure diagram of 2LXQ

     

Circular dichroism spectra of the 2LXQ oligonucleotide (10 µM), acquired at 25°C in 0.4-cm path-length cuvettes

Circular dichroism spectra of the 2LXQ oligonucleotide (10 µM), acquired at 25°C in 0.4-cm path-length cuvettes

 

$^{1}$H-NMR spectrum of the 2LXQ oligonucleotide, acquired at 25°C in 100 mM TMAA (pH 7.0) + 1 mM KCl

\(^{1}\)H-NMR spectrum of the 2LXQ oligonucleotide, acquired at 25°C in 100 mM TMAA (pH 7.0) + 1 mM KCl

 

Folded fraction of the 2LXQ oligonucleotide as a function of temperature, determined by UV-melting ($\lambda$ = 295 nm)

Folded fraction of the 2LXQ oligonucleotide as a function of temperature, determined by UV-melting (\(\lambda\) = 295 nm)

Native ESI-MS spectra of the 2LXQ oligonucleotide (10 µM)

Native ESI-MS spectra of the 2LXQ oligonucleotide (10 µM)

 

Native ESI-MS spectra of the 2LXQ oligonucleotide (10 µM), focused on the 5$^{-}$ charge state

Native ESI-MS spectra of the 2LXQ oligonucleotide (10 µM), focused on the 5\(^{-}\) charge state